ID: 1037828902_1037828920

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1037828902 1037828920
Species Human (GRCh38) Human (GRCh38)
Location 8:22176919-22176941 8:22176965-22176987
Sequence CCCAGCTCGGGACCGCCCCCCTG TGCTCCTACGTGGGTCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92} {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!