ID: 1037828907_1037828924

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1037828907 1037828924
Species Human (GRCh38) Human (GRCh38)
Location 8:22176935-22176957 8:22176970-22176992
Sequence CCCCCTGAGCTGGCCCCGCCCTC CTACGTGGGTCGCCGCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 415} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!