ID: 1037828914_1037828923

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1037828914 1037828923
Species Human (GRCh38) Human (GRCh38)
Location 8:22176950-22176972 8:22176969-22176991
Sequence CCGCCCTCCAGGTGCTGCTCCTA CCTACGTGGGTCGCCGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 374} {0: 1, 1: 0, 2: 0, 3: 4, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!