ID: 1037855408_1037855417

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1037855408 1037855417
Species Human (GRCh38) Human (GRCh38)
Location 8:22367621-22367643 8:22367673-22367695
Sequence CCTGGAGGGTGCGGGATGCTAGA GCCGCGCCGAAGGCTGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98} {0: 1, 1: 0, 2: 1, 3: 29, 4: 1064}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!