ID: 1037861989_1037861997

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1037861989 1037861997
Species Human (GRCh38) Human (GRCh38)
Location 8:22411997-22412019 8:22412020-22412042
Sequence CCCTGCCCTGGGTGGGGCTGGCC CTCCCTCCGCACGGCAGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 498} {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!