ID: 1037862205_1037862216

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1037862205 1037862216
Species Human (GRCh38) Human (GRCh38)
Location 8:22413495-22413517 8:22413535-22413557
Sequence CCCCCAAGATGATTCGACTCCCC AGTGTTGTTTCCCTGGAGGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!