ID: 1037865697_1037865711

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1037865697 1037865711
Species Human (GRCh38) Human (GRCh38)
Location 8:22440914-22440936 8:22440964-22440986
Sequence CCCGGAGCCGGAGGAGCCGAGAG CGCGGGAAGGCGGAAGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 389} {0: 1, 1: 0, 2: 2, 3: 17, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!