ID: 1037877766_1037877775

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037877766 1037877775
Species Human (GRCh38) Human (GRCh38)
Location 8:22556781-22556803 8:22556814-22556836
Sequence CCTCCCAGCACACCCAGAACTGG GGACCAAGGACAGCAAGCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 358} {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!