ID: 1037884366_1037884370

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1037884366 1037884370
Species Human (GRCh38) Human (GRCh38)
Location 8:22588681-22588703 8:22588697-22588719
Sequence CCAGGGAGGGCTCGGCTCCCCAA TCCCCAAAGCTCCACGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158} {0: 1, 1: 0, 2: 1, 3: 11, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!