ID: 1037885919_1037885926

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1037885919 1037885926
Species Human (GRCh38) Human (GRCh38)
Location 8:22596309-22596331 8:22596346-22596368
Sequence CCAGCTCAAATCCCCCTCTGGCT TGGCAGCCATCTCTCCTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 255} {0: 1, 1: 0, 2: 5, 3: 44, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!