ID: 1037885924_1037885930

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1037885924 1037885930
Species Human (GRCh38) Human (GRCh38)
Location 8:22596323-22596345 8:22596356-22596378
Sequence CCTCTGGCTCTTGTTCTTTGGTG CTCTCCTCCCAGGGGTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 236} {0: 1, 1: 0, 2: 3, 3: 46, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!