ID: 1037886037_1037886040

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1037886037 1037886040
Species Human (GRCh38) Human (GRCh38)
Location 8:22596991-22597013 8:22597007-22597029
Sequence CCAGGCACAGCTCTGGTCACCTC TCACCTCTGGTCACAACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 352} {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!