ID: 1037886829_1037886844

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1037886829 1037886844
Species Human (GRCh38) Human (GRCh38)
Location 8:22599851-22599873 8:22599894-22599916
Sequence CCCAGCCCCGCGCACCCCGCGGG CTCCCTCGCCGCCTCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 360} {0: 1, 1: 0, 2: 2, 3: 40, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!