ID: 1037886831_1037886844

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1037886831 1037886844
Species Human (GRCh38) Human (GRCh38)
Location 8:22599852-22599874 8:22599894-22599916
Sequence CCAGCCCCGCGCACCCCGCGGGC CTCCCTCGCCGCCTCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 592} {0: 1, 1: 0, 2: 2, 3: 40, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!