ID: 1037886840_1037886844

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1037886840 1037886844
Species Human (GRCh38) Human (GRCh38)
Location 8:22599880-22599902 8:22599894-22599916
Sequence CCGCGCCGCTGCGCCTCCCTCGC CTCCCTCGCCGCCTCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 379} {0: 1, 1: 0, 2: 2, 3: 40, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!