ID: 1037890210_1037890221

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1037890210 1037890221
Species Human (GRCh38) Human (GRCh38)
Location 8:22620092-22620114 8:22620127-22620149
Sequence CCTGGCTGGGGCTAAGCAGCCCC GCACAGGCTCTGCTAGGTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 281} {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!