ID: 1037929054_1037929069

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1037929054 1037929069
Species Human (GRCh38) Human (GRCh38)
Location 8:22866576-22866598 8:22866626-22866648
Sequence CCACACATAACCACTATACTAAA CCTTAAGGGGGTGGGGTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 135, 4: 1635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!