ID: 1037950460_1037950463

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1037950460 1037950463
Species Human (GRCh38) Human (GRCh38)
Location 8:23015931-23015953 8:23015949-23015971
Sequence CCTGCCTCTCTGGGCTTCTCATT TCATTCTCAGAGGTATGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 65, 4: 572} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!