ID: 1037959915_1037959922

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1037959915 1037959922
Species Human (GRCh38) Human (GRCh38)
Location 8:23089200-23089222 8:23089216-23089238
Sequence CCTACCTACTTCAGGGTAGAAAG TAGAAAGTGGGAGGAGGGAGAGG
Strand - +
Off-target summary No data {0: 4, 1: 35, 2: 346, 3: 1556, 4: 3602}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!