ID: 1037977906_1037977913

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1037977906 1037977913
Species Human (GRCh38) Human (GRCh38)
Location 8:23226062-23226084 8:23226090-23226112
Sequence CCACGCGAGTCACGGTCCTGCCT GAACTCCCAGGGCGACCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 40} {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
5 8:23226062-23226084 CCACGCGAGTCACGGTCCTGCCT - 8:23226090-23226112 GAACTCCCAGGGCGACCTTGGGG +