ID: 1037980728_1037980734

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1037980728 1037980734
Species Human (GRCh38) Human (GRCh38)
Location 8:23251497-23251519 8:23251516-23251538
Sequence CCTACTAGAAGGGAACAGTGCCA GCCATGGGCCCTGGGACCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 94} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!