ID: 1037990786_1037990795

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1037990786 1037990795
Species Human (GRCh38) Human (GRCh38)
Location 8:23320036-23320058 8:23320074-23320096
Sequence CCGCCGTTCAGGCGCAGCTGCAG ACGGTCACCAAGAGGGACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 131} {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!