ID: 1038006304_1038006309

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1038006304 1038006309
Species Human (GRCh38) Human (GRCh38)
Location 8:23433236-23433258 8:23433263-23433285
Sequence CCAGGCCCCAGAGCTGCACTTTA CTGCAACCCTACCTCTGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 343} {0: 1, 1: 0, 2: 0, 3: 21, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!