ID: 1038122107_1038122110

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1038122107 1038122110
Species Human (GRCh38) Human (GRCh38)
Location 8:24628923-24628945 8:24628936-24628958
Sequence CCTGGAAGAACAGAGAGATTTGG AGAGATTTGGGATTTGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 304} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!