ID: 1038191372_1038191374

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1038191372 1038191374
Species Human (GRCh38) Human (GRCh38)
Location 8:25324121-25324143 8:25324149-25324171
Sequence CCACCTGCTTTCTGGAGAGAGTG CATTATTACTGAGTCTTCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 256} {0: 1, 1: 0, 2: 1, 3: 15, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!