ID: 1038269591_1038269603

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1038269591 1038269603
Species Human (GRCh38) Human (GRCh38)
Location 8:26064427-26064449 8:26064479-26064501
Sequence CCTCCAAATATCTGAATTGTCAC CCATAGATCTTAGAGGACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!