ID: 1038315684_1038315694

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1038315684 1038315694
Species Human (GRCh38) Human (GRCh38)
Location 8:26482586-26482608 8:26482638-26482660
Sequence CCCATGGACTGCAGGTAAATGAG GACTCTCTCGTAGACAAGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!