ID: 1038323480_1038323485

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1038323480 1038323485
Species Human (GRCh38) Human (GRCh38)
Location 8:26551101-26551123 8:26551126-26551148
Sequence CCAATTATTCTAATCAAAAGCCA CCCTTTGAGCAGAAGAGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 10, 3: 34, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!