ID: 1038340572_1038340580

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1038340572 1038340580
Species Human (GRCh38) Human (GRCh38)
Location 8:26682017-26682039 8:26682058-26682080
Sequence CCATTGACATATCAGAAATAGGA CACTCCTGCCTGCTTGTCCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!