ID: 1038345050_1038345065

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1038345050 1038345065
Species Human (GRCh38) Human (GRCh38)
Location 8:26725061-26725083 8:26725106-26725128
Sequence CCCCACCCAAATGTCATCTTGAA GTGTCATGGGAGGGACCTGGTGG
Strand - +
Off-target summary {0: 106, 1: 8136, 2: 11485, 3: 9529, 4: 7124} {0: 277, 1: 965, 2: 2779, 3: 5347, 4: 8057}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!