ID: 1038345054_1038345067

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1038345054 1038345067
Species Human (GRCh38) Human (GRCh38)
Location 8:26725067-26725089 8:26725110-26725132
Sequence CCAAATGTCATCTTGAATAGTAG CATGGGAGGGACCTGGTGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!