ID: 1038345057_1038345066

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1038345057 1038345066
Species Human (GRCh38) Human (GRCh38)
Location 8:26725093-26725115 8:26725107-26725129
Sequence CCACGATCCCCACGTGTCATGGG TGTCATGGGAGGGACCTGGTGGG
Strand - +
Off-target summary No data {0: 442, 1: 1330, 2: 3684, 3: 5420, 4: 6963}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!