ID: 1038345061_1038345071

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1038345061 1038345071
Species Human (GRCh38) Human (GRCh38)
Location 8:26725100-26725122 8:26725125-26725147
Sequence CCCCACGTGTCATGGGAGGGACC GTGGGAGGTAATTGGATCATGGG
Strand - +
Off-target summary {0: 176, 1: 1092, 2: 2194, 3: 3472, 4: 4059} {0: 174, 1: 5218, 2: 10596, 3: 11887, 4: 9849}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!