ID: 1038345061_1038345074

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1038345061 1038345074
Species Human (GRCh38) Human (GRCh38)
Location 8:26725100-26725122 8:26725131-26725153
Sequence CCCCACGTGTCATGGGAGGGACC GGTAATTGGATCATGGGGATGGG
Strand - +
Off-target summary {0: 176, 1: 1092, 2: 2194, 3: 3472, 4: 4059} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!