ID: 1038395634_1038395641

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1038395634 1038395641
Species Human (GRCh38) Human (GRCh38)
Location 8:27243649-27243671 8:27243696-27243718
Sequence CCATGTTGGGTGAGGGCAGGGGG GGTTTTTGTACCTACCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 398} {0: 1, 1: 0, 2: 0, 3: 12, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!