ID: 1038401802_1038401815

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1038401802 1038401815
Species Human (GRCh38) Human (GRCh38)
Location 8:27289385-27289407 8:27289429-27289451
Sequence CCCAAGTTTCCTGGCCACCTTCT CTACGATGGGAGATGGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 239} {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!