ID: 1038414789_1038414793

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1038414789 1038414793
Species Human (GRCh38) Human (GRCh38)
Location 8:27387005-27387027 8:27387026-27387048
Sequence CCATACATGTATGAGGAATTTGT GTGTTTGAGCAGAATTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 124, 4: 1354} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!