ID: 1038424812_1038424815

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1038424812 1038424815
Species Human (GRCh38) Human (GRCh38)
Location 8:27458326-27458348 8:27458368-27458390
Sequence CCTGGCAGAGCTCATCAACAAGA CGCCGTGACCTCCCTAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 135} {0: 1, 1: 0, 2: 11, 3: 188, 4: 927}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!