ID: 1038425523_1038425532

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1038425523 1038425532
Species Human (GRCh38) Human (GRCh38)
Location 8:27461810-27461832 8:27461824-27461846
Sequence CCCCCCATTCACAGCCCCTGCAC CCCCTGCACAGGCGGCCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 341} {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!