ID: 1038439659_1038439661

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1038439659 1038439661
Species Human (GRCh38) Human (GRCh38)
Location 8:27562549-27562571 8:27562564-27562586
Sequence CCTTGCACCAGCTGTTAGGCAAG TAGGCAAGTGCCTTGTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141} {0: 1, 1: 0, 2: 2, 3: 43, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!