ID: 1038439659_1038439667

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1038439659 1038439667
Species Human (GRCh38) Human (GRCh38)
Location 8:27562549-27562571 8:27562593-27562615
Sequence CCTTGCACCAGCTGTTAGGCAAG AGCATCCTGCCTTAGAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!