ID: 1038441404_1038441414

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1038441404 1038441414
Species Human (GRCh38) Human (GRCh38)
Location 8:27573147-27573169 8:27573196-27573218
Sequence CCGGAGCTGATTATTCACAGCCA CTGGAGTGGGGCATTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!