ID: 1038441406_1038441415

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1038441406 1038441415
Species Human (GRCh38) Human (GRCh38)
Location 8:27573177-27573199 8:27573201-27573223
Sequence CCTCTCTCTGTGAGAACAGCTGG GTGGGGCATTGGGCAGGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 77, 4: 736}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!