ID: 1038454930_1038454939

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1038454930 1038454939
Species Human (GRCh38) Human (GRCh38)
Location 8:27666958-27666980 8:27666988-27667010
Sequence CCCTCCACCGGACTCCAGGGTGT CCTCTCCTTCCCACGCACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 161} {0: 1, 1: 0, 2: 2, 3: 46, 4: 1093}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!