ID: 1038462446_1038462464

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1038462446 1038462464
Species Human (GRCh38) Human (GRCh38)
Location 8:27728504-27728526 8:27728552-27728574
Sequence CCAGCGGCTAATCCTCCCTAAAC TTCTGGAGGGGCCGTCGCTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!