ID: 1038493744_1038493756

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1038493744 1038493756
Species Human (GRCh38) Human (GRCh38)
Location 8:27987620-27987642 8:27987653-27987675
Sequence CCCTGCAACAGCTGCAGAGAAGG GGAGAGGGAGGACGAAGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 295} {0: 1, 1: 0, 2: 5, 3: 81, 4: 837}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!