|
Left Crispr |
Right Crispr |
| Crispr ID |
1038545958 |
1038545968 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:28425872-28425894
|
8:28425890-28425912
|
| Sequence |
CCATCCTCCCGCCTCACCCCCTG |
CCCTGAGTAGCTGGGACCGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 26, 3: 395, 4: 3383} |
{0: 2, 1: 234, 2: 7563, 3: 61083, 4: 182378} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|