ID: 1038568519_1038568525

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1038568519 1038568525
Species Human (GRCh38) Human (GRCh38)
Location 8:28639571-28639593 8:28639589-28639611
Sequence CCTACCTCTTTATACTTCCCCTC CCCTCTTGGTCCCTGCGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 460} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!