ID: 1038575659_1038575665

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1038575659 1038575665
Species Human (GRCh38) Human (GRCh38)
Location 8:28701685-28701707 8:28701699-28701721
Sequence CCGAGGAGCGGGGGCCGCGCCCG CCGCGCCCGGAAGGGCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 251} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!