ID: 1038609723_1038609734

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1038609723 1038609734
Species Human (GRCh38) Human (GRCh38)
Location 8:29049262-29049284 8:29049305-29049327
Sequence CCCACATGGATTTATTGTCATAC CGCAATGGGGAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 131} {0: 1, 1: 1, 2: 7, 3: 85, 4: 800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!